>Base quality by position

>A colleague of mine was working on a nifty tool to give graphs of the base quality at each position in a read using Eland Export files, which could be incorporated into his pipeline. Over a discussion about the length of time it should take to do that analysis, (His script was taking an hour, and I said it should take about a minute to analyze 8M illumina reads…) I ended up saying I’d write my own version to do the analysis, just to show how quickly it could be done.

Well, I was wrong about it taking about a minute. It turns out that the file has a lot more than about double the originally quoted 8 million reads (QC, no match and multi match reads were not previously filtered), and the whole file was bzipped, which adds to the processing time.

Fortunately, I didn’t have to add bzip support in to the reader, as tcezard (Tim) had already added in a cool “PIPE” option for piping in whatever data format I want in to applications of the Vancouver Short Read Analysis Package, thus, I was able to do the following:

time bzcat /archive/solexa1_4/analysis2/HS1406/42E6FAAXX_7/42E6FAAXX_7_2_export.txt.bz2 | java6 src/projects/maq_utilities/QualityReport -input PIPE -output /projects/afejes/temp -aligner elandext

Quite a neat use of piping, really.

Anyhow, the fun part is that this was that the library was a 100-mer illumina run, and it makes a pretty picture. Slapping the output into openoffice yields the following graph:

I didn’t realize quality dropped so dramatically at 100bp – although I remember when qualities looked like that for 32bp reads…

Anyhow, I’ll include this tool in Findpeaks 4.0.8 in case any one is interested in it. And for the record, this run took 10 minutes, of which about 4 were taken up by bzcat. Of the 16.7M reads in the file, only 1.5M were aligned, probably due to the poor quality out beyond 60-70bp.

>Recursive MC solution to a simple problem…

>I’m trying to find balance between writing and experiments/coding. You can’t do both at the same time without going nuts, in my humble opinion, so I’ve come up with the plan of alternating days. One day of FindPeaks work, one day on my project. At that rate, I may not give the fastest responses (yes, I have a few emails waiting), but it should keep me sane and help me graduate in a reasonable amount of time. (For those of you waiting, tomorrow is FindPeaks day.)

That left today to work on the paper I’m putting together. Unfortunately, working on the paper doesn’t mean I don’t have any coding to do. I had a nice simulation that I needed to run: given the data sets I have, what are the likely overlaps I would expect?

Of course, I hate solving a problem once – I’d rather solve the general case and then plug in the particulars.

Today’s problem can be summed up as: “Given n data sets, each with i_n genes, what is the expected number of genes common to each possible overlap of 2 or more datasets?”

My solution, after thinking about the problem for a while, was to use a recursive solution. Not surprisingly, I haven’t written recursive code in years, so I was a little hesitant to give it a shot. In contrast, I whipped up the code, and gave it a shot – and it worked the first time. (That’s sometimes a rarity with my code – I’m a really good debugger, but can often be sloppy when writing code quickly the first time.) Best of all, the code is extensible – If I have more data sets later, I can just add them in and re-run. No code modification needed beyond changing the data. (Yes, I was sloppy and hard coded it, though it would be trivial to read it from a data file, if someone wants to re-use this code.)

Anyhow, it turned out to be an elegant solution to a rather complex problem – and I was happy to see that the results I have for the real experiment stick out like a sore thumb: it’s far greater than random chance.

If anyone is interested in seeing the code, it was uploaded into the Vancouver Short Read Analysis Package svn repository: here. (I’m doubting the number of page views that’ll get, but what the heck, it’s open source anyhow.)

I love it when code works properly – and I love it even more when it works properly the first time.

All in all, I’d say it’s been a good day, not even counting the 2 hours I spent at the fencing club. En gard! (-;

>new repository of second generation software

>I finally have a good resource for locating second gen (next gen) sequencing analysis software. For a long time, people have just been collecting it on a single thread in the bioinformatics section of the SeqAnswers.com forum, however, the brilliant people at SeqAnswers have spawned off a wiki for it, with an easy to use form. I highly recommend you check it out, and possibly even add your own package.

http://seqanswers.com/wiki/SEQanswers

>SNP Datatabase v0.1

>Good news, my snp database seems to be in good form, and is ready for importing SNPs. For people who are interested, you can download the Vancouver Short Read Package from SVN, and find the relevant information in
/trunk/src/transcript_analysis/SNP_Database/

There’s a schema for setting up the tables and indexes, as well as applications for running imports from maq SNP calls and running a SNP caller on any form of alignment supported by FindPeaks (maq, eland, etc…).

At this point, there are no documents on how to use the software, since that’s the plan for this afternoon, and I’m assuming everyone who uses this already has access to a postgresql database (aka, a simple ubuntu + psql setup.)

But, I’m ready to start getting feature requests, requests for new SNP formats and schema changes.

Anyone who’s interested in joining onto this project, I’m only a few hours away from having some neat toys to play with!

>SNP/SNV callers minimum useful information

>Ok, I sent a tweet about it, but it didn’t solve the frustration I feel on the subject of SNP/SNV callers. There are so many of them out there that you’d think they grow on trees. (Actually, they grow on arrays…) I’ve written one, myself, and I know there are at least 3 others written at the GSC.

Anyhow, At first sight, what pisses me off is that there’s no standard format. Frankly, that’s not even the big problem, however. What’s really underlying that problem is that there’s no standard “minimum information” content being produced by the SNP/SNV callers. Many of them give a bare minimum information, but lack the details needed to really evaluate the information.

So, here’s what I propose. If you’re going to write a SNP or SNV caller, make sure your called variations contain the following fields:

  • chromosome: obviously the coordinate to find the location
  • position: the base position on the chromo
  • genome: the version of the genome against which the snp was called (eg. hg18 vs. hg19)
  • canonical: what you expect to see at that position. (Invaluable for error checking!)
  • observed: what you did see at that position
  • coverage: the depth at that position (filtered or otherwise)
  • canonical_obs: how many times you saw the canonical base (key to evaluating what’s at that position
  • variation_obs: how many times you saw the variation
  • quality: give me something to work with here – a confidence value between 0 and 1 would be ideal… but lets pick something we compare across data sets. Giving me 9 values and asking me to figure something out is cheating. Sheesh!

Really, most of the callers out there give you most, if not all of it – but I have yet to see the final “quality” being given. The MAQ SNP caller (which is pretty good) asks you to look at several different fields and make up your own mind. That’s fine for a first generation, but maybe I can convince people that we can do better in the second gen snp callers.

Ok, now I’ve got that off my chest! Phew.

>New Project Time… variation database

>I don’t know if anyone out there is interested in joining in – I’m starting to work on a database that will allow me to store all of the snps/variations that arise in any data set collected at the institution. (Or the subset to which I have the right to harvest snps, anyhow.) This will be part of the Vancouver Short Read Analysis Package, and, of course, will be available to anyone allowed to look at GPL code.

I’m currently on my first pass – consider it version 0.1 – but already have some basic functionality assembled. Currently, it uses a built in snp caller to identify locations with variations and to directly send them into a postgresql database, but I will shortly be building tools to allow SNPs from any snp caller to be migrated into the db.

Anyhow, just putting it out there – this could be a useful resource for people who are interested in meta analysis, and particularly those who might be interested in collaborating to build a better mousetrap. (=

>Aligner tests

>You know what I’d kill for? A simple set of tests for each aligner available. I have no idea why we didn’t do this ages ago. I’m sick of off-by-one errors caused by all sorts of slightly different formats available – and I can’t do unit tests without a good simple demonstration file for each aligner type.

I know Sam format should help with this – assuming everyone adopts it – but even for SAM I don’t have a good control file.

I’ve asked someone here to set up this test using a known sequence- and if it works, I’ll bundle the results into the Vancouver Package so everyone can use it.

Here’s the 50-mer I picked to do the test. For those of you with some knowledge of cancer, it comes from tp53. It appears to blast uniquely to this location only.

>forward - chr17:7,519,148-7,519,197
CATGTGCTGTGACTGCTTGTAGATGGCCATGGCGCGGACGCGGGTGCCGG

>reverse - chr17:7,519,148-7,519,197
ccggcacccgcgtccgcgccatggccatctacaagcagtcacagcacatg

>Picard code contribution

>

Update 2: I should point out that the subject of this post has been resolved. I’ll mark it down to a misunderstanding. The patches I submitted were accepted several days after being sent and rejected, once the purpose of the patch was clarified with the developers. I will leave the rest of the post here, for posterity sake, and because I think that there is some merit to the points I made, even if they were misguided in their target.

Today is going to be a very blog-ful day. I just seem to have a lot to rant about. I’ll be blaming it on the spider and a lack of sleep.

One of the things that thrills me about Open Source software is the ability for anyone to make contributions (above and beyond the ability to share and understand the source code) – and I was ecstatic when I discovered the java based Picard project, an open source set of libraries for working with SAM/BAM files. I’ve been slowly reading through the code, as I’d like to use it in my project for reading/writing SAM format files – which nearly all of the aligners available are moving towards.

One of those wonderful tools that I use for my own development is called Enerjy. It’s an Eclipse plug-in designed to help you write better java code by making suggestions about things that can be improved. A lot of it’s suggestions are simple: re-order imports to make them alphabetical (and more readable), fill in missing javadoc flags, etc. They’re not key pieces, but they are important to maintain your code’s good health. It does also point the way to things that will likely cause bugs as well (such as doing string comparisons with the “==” operator).

While reading through the Picard libraries and code, Enerjy threw more than 1600 warnings. It’s not in bad shape, but it’s got a lot of little “problems” that could easily be fixed. Mainly a lot of missing javadoc, un-cast generic types, arrays being passed between classes and the like. As part of my efforts to read through and understand the code, which I want to do before using it, I figured I’d fix these details. As I ramped up into the more complex warnings, I wanted to start small while still making a contribution. Open source at it’s best, right?

The sad part of the tale is that open source only works when the community’s contributions are welcome. Apparently, with Picard, code cleaning and maintenance isn’t. My first set of patches (dealing mainly with the trivial warnings) were rejected. With that reception, I’m not going to waste my time submitting the second set of changes I made. That’s kind of sad, in my opinion. I expressly told them that these patches were just a small start and that I’d begin making larger code contributions as my familiarity with the code improves – and at this rate, my familiarity with the code is definitely not going to mature as quickly, since I have much less motivation to clean up their warnings if they themselves aren’t interested in fixing them.

At any rate, perhaps I should have known. Open source in science usually means people have agendas about what they’d like to accomplish with the software – and including contributions may mean including someone on a publication downstream if and when it does become published. I don’t know if that was the case here: it was well within the project leader’s rights to reject my patches on any grounds they like, but I can’t say it makes me happy. I still don’t enjoy staring at 1600+ warnings every time I open Eclipse.

The only lesson I take away from this is that next time I see “Open Source” software, I’ll remember that just because it’s open source, it doesn’t mean all contributions are welcome – I should have confirmed with the developers before touching the code that they are open to small changes, and not just bug fixes. In the future, I suppose I’ll be tempering my excitement for open source science software projects.

update: A friend of mine pointed me to a link that’s highly related. Anyone with an open source project (or interested in getting started in one) should check out this blog post titled Teaching people to fish.

>Community

>This week has been a tremendous confluence of concepts and ideas around community. Not that I’d expect anyone else to notice, but it really kept building towards a common theme.

The first was just a community of co-workers. Last week, my lab went out to celebrate a lab-mate’s successful defense of her thesis (Congrats, Dr. Sleumer!). During the second round of drinks (Undrinkable dirty martinis), several of us had a half hour conversation on the best way to desalinate an over-salty martini. As weird as it sounds, it was an interesting and fun conversation, which I just can’t imagine having with too many people. (By the way, I think Obi’s suggestion wins: distillation.) This is not a group of people you want to take for granted!

The second community related event was an invitation to move my blog over to a larger community of bloggers. While I’ve temporarily declined, it raised the question of what kind of community I have while I keep my blog on my own server. In some ways, it leaves me isolated, although it does provide a “distinct” source of information, easily distinguishable from other people’s blogs. (One of the reasons for not moving the larger community is the lack of distinguishing marks – I don’t want to sink into a “borg” experience with other bloggers and just become assimilated entirely.) Is it worth moving over to reduce the isolation and become part of a bigger community, even if it means losing some of my identity?

The third event was a talk I gave this morning. I spent a lot of time trying to put together a coherent presentation – and ended talking about my experiences without discussing the actual focus of my research. Instead, it was on the topic of “successes and failures in developing an open source community” as applied to the Vancouver Short Read Analysis Package. Yes, I’m happy there is a (small) community around it, but there is definitely room for improvement.

Anyhow, at the risk of babbling on too much, what I really wanted to say is that communities are all around us, and we have to seriously consider our impact on them, and the impact they have on us – not to mention how we integrate into them, both in our work and outside. If you can’t maximize your ability to motivate them (or their ability to motivate you), then you’re at a serious disadvantage. How we balance all of that is an open question, and one I’m still working hard at answering.

I’ve attached my presentation from this morning, just in case anyone is interested. (I’ve decorated it with pictures from the South Pacific, in case all of the plain text is too boring to keep you awake.)

Here it is (it’s about 7Mb.)

>Science Cartoons – 3

>I wasn’t going to do more than one comic a day, but since I just published it into the FindPeaks 4.0 manual today, I may as well put it here too, and kill two birds with one stone.

Just to clarify, under copyright laws, you can certainly re-use my images for teaching purposes or your own private use (that’s generally called “fair use” in the US, and copyright laws in most countries have similar exceptions), but you can’t publish it, take credit for it, or profit from it without discussing it with me first. However, since people browse through my page all the time, I figure I should mention that I do hold copyright on the pictures, so don’t steal them, ok?

Anyhow, Comic #3 is a brief description of how the compare in FindPeaks 4.0 works. Enjoy!